Home |  JournalSeek |  SoftwareSeek |  GenomeSeek |  Expression |  Developer |  Research
Return to Genamics Home

Annotating Your Sequences

The Sequence Editor in Expression allows you to fully annotate your sequences with extra information. This section guides you through the key aspects of the Sequence Editor and how to get the most out of sequence annotation.

Why Annotate?

Annotating your sequences has a number of advantages:

  • You can mark out important regions in your sequences, such as mutations, cut sites, start and stop signals, transcription factor binding sites, probe or primer binding sites.
  • A graphical map of your annotated sequence is generated on the fly, giving you an instant overview of the important aspects of your sequence.
  • An annotated sequence can be navigated using the Sequence Map, allowing you to instantly jump to the regions you're interested in.
  • You can do away with cumbersome line numbers in your sequences, and counting out residues to find a particular spot.
  • Expression understands a number of tags in annotated sequences, which allows the software to intelligently perform tasks for you, without you needing to do anything!

How to Annotate

Sequences can be annotated in Expression in three primary ways:

  • Importing sequence data from GenBank using the NCBI Query tool from the Internet menu.
  • Selecting Annotate while using either the Primer Designer, Enzyme Digestor, or ORF Mapper tools.
  • Entering them yourself in the Sequence Editor.

Annotation Notation

Annotating your sequences is really simple and just requires the knowledge of a little notation. The annotation, or tags as we will refer to them as, are very similar to those used in HTML (the language used to format web pages). If you're already famililar with HTML then you will find sequence tagging very natural.

The tags are distinguished from your sequence by < and > symbols. Tagged regions are automatically coloured blue. These are referred to as the tag names. eg

GATCGAT<RBS>CAGCTACATGCGATCGATCGATGCTAGCTAGCTAGCATATGCTAGCATTG
ATAGCATGCATTGAGCACGATAGCTAGCTGAGCTAGTCGAAT

To define a region, you simplify repeat the same tag at the end of the region with a / character at the front. We refer to the tags around regions as start tags and end tags. eg

GATCGAT<RBS>GAGGTG</RBS>CAGCTACATGCGATCGATCGATGCTAGCTAGCTAG
CATATGCTAGCATTGATAGCATGCATTGAGCACGATAGCTAGCTGAGCTAGTCGAAT

As soon as a tag is made, it is drawn real-time on the Sequence Map, so a direct correlation between the sequence editor and the graphical is always maintained. Single tags are represented on the map as a point and a pair of tags flanking a region is shown as a purple bar. What's more, if you click on the labels on the Sequence Map, it will automatically take you to that the region in the sequence editor. This facility can be very useful for finding your way around long sequences.

For longer descriptions, you can also add comments to your tag. You can add comments to either the start or end tags - you don't need them in both. Comments are addeded in quote marks after the tag name. eg

GATCGAT<RBS 'Ribosome binding site'>GAGGTG</RBS>CAGCTACATGCGATCGATC
GATGCTAGCTAGCTAGCATATGCTAGCATTGATAGCATGCATTGAGCACGATAGCT
AGCTGAGCTAGTCGAAT

Pretty simple so far right? Where Expression gets really clever is in its utilisation of some other special tags, which help the program understand the meaning of your sequence. The first of these are the + and - prefixes. These are used to tell Expression which regions are protein-coding, and whether they are on the sense (+) or antisense (-) strand. eg

GATCGAT<RBS 'Ribosome binding site'>GAGGTG</RBS>CAGCTAC<+CDS>ATGCG
ATCGATCGATGCTAGCTAGCTAGCATATGCTAGCATTGATAGCATGCATTGA</CDS>GC
ACGATAGCTAGCTGAGCTAGTCGAAT

Coding regions are represented on the Sequence Map as arrows, with their direction showing which way the sequence would be transcribed. When you click on the label of a coding region on the Sequence Map, the corresponding sequence is automatically translated, and the resulting amino acid sequence is shown in a panel at the bottom of the Sequence Editor.

The other special tag recognised by Expression is exon. When you select a label associated with an exon tag on the Sequence Map, Expression intelligently finds the other associated exons and provides the complete translation for the whole gene. eg

ACGTGACTAGCTAGC<+exon1>ATGCATGCATGCAGCATCGATCGATCGATCGATGCAT
CGAGCATGCAGCTAG</exon1>CTAGCTAGTCAGCTAGT<+exon2>CAGTAGCTAGCT
AGCTAGCTAGAGCATCACACGACGACTAGCACACGATCGACGACTATCGACGACGACAGC
ATCGACATCAGCAGCAGACGACGATCGCACGACGATCGACAGCTAGC</exon2>TAGCATC

As explained above, the + prefix in this example denotes that the exon is on the sense strand. If you're examining a sequence with multiple genes, each consisting of multiple exons, the different groups of exons are differentiated by a letter following the exon number, eg the tag names, exon1a, exon2a, exon3a, exon1b, exon2b, would be interpreted as two genes; the first with three exons and the second with two.

Summary

The following is a brief summary of the notation used by Expression to annotate your sequences:

SymbolNameFunction
< >Tag MarkerEncapsulates tag names and comments.
/End PrefixUsed to mark the end of a sequence region.
' 'Comment MarkerEncapsulates additional comments within your tag.
+Plus Coding PrefixDenotes that the region is protein-coding on the plus (sense) strand.
-Minus Coding PrefixDenotes that the region is protein-coding on the minus (anti-sense) strand.
exonnExon TagDenotes that the region is the nth exon in a series of exons. Requires a + or - prefix.

Related Articles

Using the Sequence Map

Importing sequences from GenBank and other sources

Return to Expression Overview

DNA Sequence Annotation

Get the latest Research on Vasectomy.

Learn more about topics such as Vasectomy Reversal.

Vasectomy Research is a new free online publication from Research Today Publications.








Add To Favorites
Email This Page

Introduction
Tutorial
Download
Order

Online Tutorial

Overview
Sequence Annotation
Graphical Map
Restriction Analysis
Primer Design
ORF Prediction
Pattern Finding
Reverse Translation
GenBank Searching
Pattern Identification
Multiple Alignment
DNA/Protein Calculator




Side Panel
Privacy Policy About Us Contact Us